Quick Order

Mouse CGR2 / CD32 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FCGR2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001077189.1
RefSeq ORF Size:1023bp
cDNA Description:Full length Clone DNA of Mus musculus Fc receptor, IgG, low affinity IIb with C terminal Flag tag.
Gene Synonym:CD32, Fcgr2, Fcr-2, Fcr-3, Ly-17, LyM-1, Lym-1, FcgRII, Fcgr2a, Ly-m20, AI528646, Fc[g]RII, F630109E10Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mFCGR2-Flag
Restriction Site:KpnI + XbaI (6kb + 1.06kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FCGR2 Gene Plasmid Map
Mouse CGR2 / CD32 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Receptors for Fc portion of IgG (Fcγ Rs) are members of the Ig superfamily, and are divided into three classes designated Fcγ RI (CD64), Fcγ RII (CD32), and Fcγ RIII (CD16). CD32 protein is a low affinity receptor for IgG that binds only IgG immune complexes and is expressed on a diverse range of cells such as monocytes, macrophages, neutrophils, eosinophils, platelets, and B cells. Human CD32 class is encoded by three closely related genes, and designated Fcγ RII A, B, and C which share 94-99% amino acid identity in their extracellular domains but differ substantially in their transmembrane and cytoplasmic domains. CD32 is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators, and regulation of antibody production.

References
  • Williams TE, et al. (2000) Concurrent and independent binding of Fcgamma receptors IIa and IIIb to surface-bound IgG. Biophys J. 79(4): 1867-75.
  • Kanters D, et al. (2007) Expression of activated Fc gamma RII discriminates between multiple granulocyte-priming phenotypes in peripheral blood of allergic asthmatic subjects. J Allergy Clin Immunol. 120(5): 1073-81.
  • Veri MC, et al. (2007) Monoclonal antibodies capable of discriminating the human inhibitory Fcgamma-receptor IIB (CD32B) from the activating Fcgamma-receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 121(3): 392-404.
  • Size / Price
    Catalog: MG50030-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"