After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse sFRP-2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SFRP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_009144.1
RefSeq ORF Size:888bp
cDNA Description:Full length Clone DNA of Mus musculus secreted frizzled-related protein 2 with C terminal Flag tag.
Gene Synonym:Sdf5, AI851596
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mSFRP2-flag
Restriction Site:KpnI + XbaI (6kb + 0.93kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The Secreted frizzled-related protein (SFRP) family consists of five secreted glycoproteins in humans (SFRP1~5) that act as extracellular signaling ligands. Each SFRP is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. sFRP2 is a member of the SFRP family acting as soluble modulators of Wnt signaling and contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain.sFRP2 inhibites hypoxia induced endothelial cell apoptosis and increases endothelial cell migration. It prevents mesoderm specification and maintains the cells in the undifferentiated state. SFRP2 is also a novel stimulator of angiogenesis that stimulates angiogenesis via a calcineurin/NFAT pathway, thus is regarded as a favorable target for the inhibition of angiogenesis in solid tumors. Mouse sFRP2 is highly expressed in the eye and is also detected in heart and lung at low level.

Size / Price
Catalog: MG50028-CF
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"