After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MICB ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MICB cDNA Clone Product Information
Gene_bank_ref_id:NM_005931.2
RefSeq ORF Size:1152bp
cDNA Description:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence B with N terminal HA tag.
Gene Synonym:PERB11.2, MICB
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

References
  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Size / Price
    Catalog: HG10759-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"