After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CCL6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL6cDNA Clone Product Information
cDNA Size:390
cDNA Description:ORF Clone of Mus musculus chemokine (C-C motif) ligand 6 DNA.
Gene Synonym:c10, MRP-1, Scya6
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Chemokine & Receptor Related Products
Product nameProduct name

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.

    CCL6/C10 related areas, pathways, and other information

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Mouse CCL6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items