Quick Order

Text Size:AAA

Human DAPK3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DAPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001348.1
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens death-associated protein kinase 3 with N terminal HA tag.
Gene Synonym:ZIP, ZIPK, FLJ36473, DAPK3
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

References
  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • Size / Price
    Catalog: HG10757-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"