Quick Order

Mouse CXADR transcript variant 1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CXADR cDNA Clone Product Information
Gene_bank_ref_id:NM_001025192.2
RefSeq ORF Size:1098bp
cDNA Description:Full length Clone DNA of Mus musculus coxsackie virus and adenovirus receptor, transcript variant 1 with C terminal Flag tag.
Gene Synonym:CAR, MCAR, MCVADR, AU016810, AW553441, 2610206D03Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mCXADR-flag
Restriction Site:KpnI + XbaI (6kb + 1.14kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

References
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • Size / Price
    Catalog: MG50019-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"