Quick Order

Text Size:AAA

Human RFK ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RFK cDNA Clone Product Information
Gene_bank_ref_id:BC007069.1
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens riboflavin kinase with N terminal His tag.
Gene Synonym:RIFK, RP11-422N19.2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Flavokinase is a member of the transferases family, specifically those transferring phosphorus-containing groups (phosphotransferases) with an alcohol group as acceptor. Flavokinase is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis. It has been proposed that TNF, through the activation of the flavokinase gene, enhances the incorporation of FAD in NADPH oxidase enzymes, which is a critical step for the assembly and activation of NADPH oxidase.

References
  • Hirano G, et al. (2011) Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin. Int J Oncol. 38(4):893-902.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    Catalog: HG13881-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"