Quick Order

Text Size:AAA

Mouse MEP1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MEP1AcDNA Clone Product Information
cDNA Size:2283
cDNA Description:ORF Clone of Mus musculus meprin 1 alpha DNA.
Gene Synonym:Mep1, Mep-1, Mep-1a, AI098089, AW107200, Mep1a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I  membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).

  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items