Quick Order

Text Size:AAA

Human HSD11B1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSD11B1cDNA Clone Product Information
Gene_bank_ref_id:BC012593
cDNA Size:924
cDNA Description:ORF Clone of Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1 DNA.
Gene Synonym:HDL, 11-DH, HSD11, HSD11B, HSD11L, CORTRD2, SDR26C1, 11-beta-HSD1
Species:Human
Vector:pCMV3-C-His
Restriction Site:KpnI + XbaI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"