Quick Order

Text Size:AAA

Mouse Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LXNcDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Mus musculus latexin DNA.
Gene Synonym:MGC144352, MGC144353, Lxn
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Mouse Latexin, also known as endogenous carboxypeptidase inhibitor, tissue carboxypeptidase inhibitor, TCI, ECI and LXN, is a cytoplasm protein which belongs to the protease inhibitor I47 (latexin) family. It is highly expressed in heart, prostate, ovary, kidney, pancreas, and colon. Latexin / LXN is the only known endogenous specific inhibitor of zinc-dependent metallocarboxypeptidases (MCPs) present in mammalians so far. Latexin is originally identified as a molecular marker for the regional specification of the neocortex in development in rats. The 222 amino acid latexin in human shows different expression distribution with high levels in heart, prostate, ovary, kidney, pancreas, and colon, but only moderate or low levels in other tissues including brain. Latexin is also expressed at high levels and is inducible in macrophages in concert with other protease inhibitors and potential protease targets, and thus is suggested to play a role in inflammation and innate immunity pathways. Despite of the non-detectable sequence similarity with plant and parasite inhibitors, Latexin is related to a human putative tumor suppressor protein, TIG1. In addition, Latexin is also implicated in Alzheimer's disease.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items