Quick Order

Mouse ANPEP ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ANPEP cDNA Clone Product Information
Gene_bank_ref_id:NM_008486.1
RefSeq ORF Size:2901bp
cDNA Description:Full length Clone DNA of Mus musculus alanyl (membrane) aminopeptidase with C terminal Flag tag.
Gene Synonym:Apn, Cd13, Lap-1, Lap1, p150
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the small-intestinal and renal microvillar membrane, as well as other plasma membranes. It belongs to the peptidase M1 family. CD13 plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases and is involved in the metabolism of regulatory peptides by diverse cell types. CD13/APN is a potent regulator of angiogenesis which is essential for tumor invasion and metastasis, and its transcription in activated endothelial cells is induced by angiogenic growth factors via the RAS/MAPK pathway. In addition, this enzyme has been shown to participate in antigen processing and presentation, and accordingly, defects in this gene appear to be a cause of various types of leukemia or lymphoma and carcinomas.

References
  • Pasqualini R, et al. (2000) Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis.Cancer Res. 60(3): 722-7.
  • Mabjeesh SJ, et al. (2005) Aminopeptidase N gene expression and abundance in caprine mammary gland is influenced by circulating plasma peptide. J Dairy Sci. 88(6): 2055-64.
  • Dunkel B, et al. (2009) Neutrophil and platelet activation in equine recurrent airway obstruction is associated with increased neutrophil CD13 expression, but not platelet CD41/61 and CD62P or neutrophil-platelet aggregate formation. Vet Immunol Immunopathol. 131(1-2): 25-32.
  • Size / Price
    Catalog: MG50001-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"