After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DYRK3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DYRK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_003582.2
RefSeq ORF Size:1767bp
cDNA Description:Full length Clone DNA of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 with N terminal HA tag.
Gene Synonym:RED, REDK, DYRK5, hYAK3-2, DYRK3
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a nucleus protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MNB/DYRK subfamily. DYRKs are an emerging family of dual-specificity kinases that play key roles in cell proliferation, survival, and development. DYRK3 contains one protein kinase domain. Isoform 1 and isoform 2 of DYRK3 are highly expressed in testis and in hematopoietic tissue such as fetal liver, and bone marrow. Isoform 2 of DYRK3 is the predominant form in testis. Isoform 1 of DYRK3 is the predominant form in fetal liver and bone marrow. Isoform 1 and isoform 2 are present at low levels in heart, pancreas, lymph node, and thymus. DYRK3 is a negative regulator of EPO-dependent erythropoiesis. It may place an upper limit on red cell production during stress erythropoiesis. DYRK3 inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells. It may also act by regulating CREB/CRE signaling. DYRK3 proved to effectively inhibit NFAT (nuclear factor of activated T cells) transcriptional response pathways and to co-immunoprecipitate with NFATc3. DYRK3 attenuates (and possibly apportions) red cell production selectively during anemia.

References
  • Becker W., et al., 1998, J. Biol. Chem. 273: 25893-25902.
  • Himpel,S. et al., 2000,J Biol Chem  275 (4):2431-8.
  • Li,K. et al., 2002, J Biol Chem. 277 (49):47052-60.
  • Bogacheva,O. et al., 2008, J Biol Chem. 283 (52):36665-75.
  • Guo,X. et al., 2010, J Biol Chem.285 (17):13223-32.
  • Size / Price
    Catalog: HG10726-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"