Quick Order

Human sFRP-4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SFRP4 cDNA Clone Product Information
Gene_bank_ref_id:NM_003014.3
RefSeq ORF Size:1041bp
cDNA Description:Full length Clone DNA of Homo sapiens secreted frizzled-related protein 4 with N terminal HA tag.
Gene Synonym:FRP-4, FRPHE, MGC26498, SFRP4
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-SFRP4
Restriction Site:KpnI + XbaI (6kb + 1.08kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 822 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SFRP family consists of five secreted glycoproteins in humans acting as extracellular signaling ligands. Each is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs act as soluble modulators of Wnt signaling, counteracting Wnt-induced effects at high concentrations and promoting them at lower concentrations. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. SFRP4 is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain . Mouse SFRP4 is highly expressed in the ovary, and is localized to granulosa cells of periovulatory follicles and corpora lutea. It plays a critical role in placental development and implantation, and is also an important factor in the development of the decidual fibrinoid zone, and in trophoblast apoptosis.

Size / Price
Catalog: HG10717-NY
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"