After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CLK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLK3cDNA Clone Product Information
cDNA Size:1473
cDNA Description:ORF Clone of Homo sapiens CDC-like kinase 3 DNA.
Gene Synonym:PHCLK3, FLJ22858, PHCLK3/152, CLK3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC Ser/Thr protein kinase family and Lammer subfamily. Mammalian CLK is the prototype for a family of dual specificity kinases (termed Lammer kinases) that have been conserved in evolution. CLK family members have shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. The three members of the CLK family of kinases (CLK1, CLK2, and CLK3) have been shown to undergo conserved alternative splicing to generate catalytically active and inactive isoforms. The human CLK2 and CLK3 are found within the nucleus and display dual-specificity kinase activity. The truncated isoforms, hCLK2(T) and hCLK3(T), colocalize with SR proteins in nuclear speckles. CLK3 may play a role in the development and progression of azoospermia.

  • Duncan, PI. et al., 1998, Exp. Cell Res. 241: 300 - 8.
  • Menegay, H. et al., 1999, Exp Cell Res. 253 (2): 463-73.
  • García-Sacristán, A. et al., 2005, Cell Res. 15 (7): 495-503.
  • Bullock, AN. et al., 2009, Structure  17 (3): 352-62.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items