Quick Order

Mouse CREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CREB1cDNA Clone Product Information
cDNA Size:864
cDNA Description:ORF Clone of Mus musculus cAMP responsive element binding protein 1 DNA.
Gene Synonym:Creb, Creb-1, AV083133, 2310001E10Rik, 3526402H21Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CAMP responsive element binding protein 1, also known as CREB-1, plays multiple functions as a transcription factor in gene regulation. This protein is a CREB transcription factor that is a member of the leucine zipper family of DNA-binding proteins. CREB1 proteins are also known to be expressed in several spliced isoforms that act as transcriptional activators or repressors. The activator isoforms, possessing the functional domains for kinase induction and for interaction with other transcriptional regulators, act as transcriptional activators.The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. CREB-1 has a complex influence on behavioural responses to drugs of abuse which varies depending on the brain region in which it is expressed. CREB-1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. 

  • Sadamoto H, et al. (2011) Direct observation of dimerization between different CREB1 isoforms in a living cell. PLoS One. 6 (6): e20285.
  • Liu RY, et al. (2011) The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia. J Neurosci. 31 (18): 6871-9.
  • Hoeffler JP, et al. (1988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science. 242 (4884): 1430-3.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks