After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse OSTM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OSTM1cDNA Clone Product Information
cDNA Size:1017
cDNA Description:ORF Clone of Mus musculus osteopetrosis associated transmembrane protein 1 DNA.
Gene Synonym:gl, HSPC019, 1200002H13Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I  membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).


1.  Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2.  Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3.  Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4.  Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5.  Feigin, al., 2008, Cell Signal. 20 (5): 949-957.  

6.  Pata, al., 2008, J Biol Chem. 283 (45): 30522-30530.