Quick Order

Text Size:AAA

Mouse CAXII ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CA12 cDNA Clone Product Information
Gene_bank_ref_id:NM_178396.3
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Mus musculus carbonic anyhydrase 12 with N terminal Flag tag.
Gene Synonym:AI314958, 2310047E01Rik
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA12, also known as Car12 and carbonic anhydrase XII, is a type I  membrane enzyme of an N-terminal extracellular catalytic domain, a membrane-spanning α-helix, and a small intracellular C-terminal domain. It is highly expressed in colon, kidney, prostate, intestine and activated lymphocytes and moderately expressed in pancreas, ovary, and testis. Overexpression of the CA12 is observed in certain human cancers and is used as a tumor marker. rmCA12 corresponds to the extracellular domain and has both carbonic anhydrase activity and esterase activity.

References
  • Sahin, U. et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 92 (25): 11810–11813.
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596 - 12601.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 16903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Catalog: MG50014-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"