Quick Order

Human SRPK1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SRPK1 cDNA Clone Product Information
Gene_bank_ref_id:BC038292
RefSeq ORF Size:1968bp
cDNA Description:Full length Clone DNA of Homo sapiens SFRS protein kinase 1 with C terminal HA tag.
Gene Synonym:SFRSK1, SRPK1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine / threonine-protein kinase SRPK1, also known as SFRS protein kinase 1, Serine/arginine-rich protein-specific kinase 1, SR-protein-specific kinase 1 and SRPK1, is a cytoplasm and nucleus protein which belongs to the protein kinase superfamily and CMGC Ser/Thr protein kinase family. Isoform 2 of SRPK1 is predominantly expressed in the testis but is also present at lower levels in heart, ovary, small intestine, liver, kidney, pancreas and skeletal muscle. Isoform 1 of SRPK1 is only seen in the testis, at lower levels than isoform 2. SRPK1 hyperphosphorylates RS domain-containing proteins such as SFRS1, SFRS2 and ZRSR2 on serine residues during metaphase but at lower levels during interphase. SRPK1 plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. SRPK1 locks onto SFRS1 to form a stable complex and processively phosphorylates the RS domain. SRPK1 appears to mediate HBV core protein phosphorylation which is a prerequisite for pregenomic RNA encapsidation into viral capsids.

References
  • Ngo J.C.K. et al., 2005, Mol. Cell 20:77-89.
  • Krishnakumar,S. et al., 2008, Pediatr Blood Cancer 50 (2):402-6.
  • Ma,C.T. et al., 2009, J Mol Biol  390 (4):618-34.
  • Souki S.K. et al., 2009, J. Virol. 83:8970-8975.
  • Choudhary C. et al., 2009, Science 325:834-840. 
  • Size / Price
    Catalog: HG12249-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"