After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CD26 / DPP-IV Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
DPP4cDNA Clone Product Information
Gene Bank Ref.ID:NM_001935.3
cDNA Size:2301
cDNA Description:ORF Clone of Homo sapiens dipeptidyl-peptidase 4 DNA.
Gene Synonym:CD26, ADABP, ADCP2, DPPIV, TP103, DPP4
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks