Quick Order

Text Size:AAA

Mouse RCN3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RCN3cDNA Clone Product Information
cDNA Size:987
cDNA Description:ORF Clone of Mus musculus reticulocalbin 3, EF-hand calcium binding domain DNA.
Gene Synonym:RLP49, D7Ertd671e, 6030455P07Rik, D530026G20Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items