After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LMAN2L Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LMAN2LcDNA Clone Product Information
Gene_bank_ref_id:BC067265
cDNA Size:1047
cDNA Description:ORF Clone of Homo sapiens lectin, mannose-binding 2-like DNA.
Gene Synonym:PSEC0028, DKFZp564L2423, MGC11139, VIPL, LMAN2L
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

LMAN2L contains 1 L-type lectin-like domain and is expressed in numerous tissues. It is highly expressed in skeletal muscle and kidney, and its intermediate expression levels in heart, liver and placenta, low levels in brain, thymus, spleen, small intestine and lung. LMAN2L may be involved in the regulation of export from the endoplasmic reticulum of a subset of glycoproteins. It also may function as a regulator of ERGIC-53. LMAN2L gene may be modulated by acetylation; phosphorylation, as detailed at PhosphoSite. Alternative splicing produces 2 isoforms of the human protein. LMAN2L localize in various compartments.

References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Size / Price
    Catalog:HG13822-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"