After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SIGLEC6 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SIGLEC6 cDNA Clone Product Information
Gene_bank_ref_id:BC035359
RefSeq ORF Size:1281bp
cDNA Description:Full length Clone DNA of Homo sapiens sialic acid binding Ig-like lectin 6 with C terminal HA tag.
Gene Synonym:CD327, CD33L, OBBP1, CD33L1, CD33L2, CDW327, SIGLEC6
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SIGLEC6, also known as CD327, belongs to the immunoglobulin superfamily, SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC6 is a sialic acid recognizing protein expressed at high levels in placenta (cyto- and syncytiotrophoblastic cells) and at lower levels in spleen, peripheral blood leukocytes (predominantly B-cells) and small intestine. SIGLEC6 localizes in various compartments such as membrane fraction, extracellular region and so on. SIGLEC6 may show increasing expression human labor and following childbirth, it has been speculated that this expression helps to slow the tempo of human labor.  Interestingly, expression of SIGLEC6 is further upregulated in pre-eclampsia, which appears to be a uniquely human disease.

References
  • Winn VD. et al., 2009, Endocrinology. 150 (1): 452-62.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Lam KK. et al., 2011, J Biol Chem. 286 (43): 37118-27.
  • Size / Price
    Catalog: HG12241-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"