After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ULBP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ULBP1cDNA Clone Product Information
Gene_bank_ref_id:NM_025218.2
cDNA Size:735
cDNA Description:ORF Clone of Homo sapiens UL16 binding protein 1 DNA.
Gene Synonym:RAET1I, ULBP1
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.

References

1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

Size / Price
Catalog:HG10679-NY
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"