After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK1A1cDNA Clone Product Information
cDNA Size:1014
cDNA Description:ORF Clone of Homo sapiens casein kinase 1, alpha 1 DNA.
Gene Synonym:CK1, HLCDGP1, PRO2975, CSNK1A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10668-ACG$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10668-ACR$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10668-ANG$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10668-ANR$325
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10668-CF$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10668-CH$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10668-CM$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10668-CY$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone)HG10668-M$95
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10668-M-F$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10668-M-N$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10668-NF$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10668-NH$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10668-NM$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10668-NY$295
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10668-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items