After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DPEP2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DPEP2 cDNA Clone Product Information
Gene_bank_ref_id:BC024021
RefSeq ORF Size:1200bp
cDNA Description:Full length Clone DNA of Homo sapiens dipeptidase 2 with N terminal His tag.
Gene Synonym:UNQ284/PRO323, MBD2, DPEP2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

DPEP2 (MBD-2) belongs to the membrane-bound dipeptidase family. There are three members of this family as membrane-bound dipeptidase-1 (MBD-1),membrane-bound dipeptidase-2 (MBD-2) and membrane-bound dipeptidase-3 (MBD-3).MBD-2 is expressed at highest levels in lung, heart, and testis and at some what lower levels in spleen.MBD-2 is membrane-bound through a glycosylphosphatidyl-inositol linkage and probably is a metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).It is generally recognized that rapid cleavage of LTD4 is important in inactivating the broncho-and vaso-constrictive effects of cysteinyl LTs in asthmatic and inflammatory processes.

References
  • Geetha M. Habib.et al.,2003,The FASEB Journal.8
  • Habib,G.M.,and Lieberman,M.W.1999,Adv.Exp.Med.Biol.469,295-300
  • Campbell, B. Jet al.,1984,J.Biol.Chem.259,14586-14590.
  • Size / Price
    Catalog: HG13806-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"