Quick Order

Text Size:AAA

Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKD3cDNA Clone Product Information
cDNA Size:2673
cDNA Description:ORF Clone of Homo sapiens protein kinase D3 DNA.
Gene Synonym:EPK2, PKD3, PRKCN, PKC-NU, nPKC-NU, PRKD3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10665-ACG$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10665-ACR$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10665-ANG$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10665-ANR$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10665-CF$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10665-CH$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10665-CM$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10665-CY$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone)HG10665-M$145
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10665-M-F$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10665-M-N$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10665-NF$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10665-NH$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10665-NM$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10665-NY$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10665-UT$445
 Learn more about expression Vectors
Related Products
Product nameProduct name

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items