Quick Order

Text Size:AAA

Human AZU1 / HBP ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AZU1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001700.3
RefSeq ORF Size:756bp
cDNA Description:Full length Clone DNA of Homo sapiens azurocidin 1 with N terminal HA tag.
Gene Synonym:AZU, HBP, NAZC, AZAMP, CAP37, HUMAZUR, AZU1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-AZU1
Restriction Site:KpnI + XbaI (6kb + 0.77kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 177C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. The Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. Azurocidin is a member of the serine protease family that includes Cathepsin G, neutrophil elastase (NE), and proteinase 3 (PR3), however, Azurocidin is not a serine proteinase since the active site serine and histidine residues are replaced. Neutrophils arriving first at sites of inflammation release Azurocidin, which acts in a paracrine fashion on endothelial cells causing the development of intercellular gaps and allowing leukocyte extravasation. It thus be regarded as a reasonable therapeutic target for a variety of inflammatory disease conditions.

References
  • Lindmark A, et al. (1999) Characterization of the biosynthesis, processing, and sorting of human HBP/CAP37/azurocidin. J Leukoc Biol. 66(4): 634-43.
  • Heinzelmann M, et al. (2001) Heparin binding protein (CAP37) differentially modulates endotoxin-induced cytokine production. Int J Surg Investig. 2(6): 457-66.
  • Soehnlein O, et al. (2005) Neutrophil-derived heparin-binding protein (HBP/CAP37) deposited on endothelium enhances monocyte arrest under flow conditions. J Immunol. 174(10): 6399-405.
  • Size / Price
    Catalog: HG10660-NY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"