After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LCN2 / NGAL natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LCN2 cDNA Clone Product Information
RefSeq ORF Size:597bp
cDNA Description:Full length Clone DNA of Homo sapiens lipocalin 2 with HA tag.
Gene Synonym:LCN2, NGAL
Restriction Site:KpnI + XhoI (5.4kb + 0.65kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.

  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
  • Size / Price
    Catalog: HG10222-M-Y
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions