After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RSV glycoprotein G / RSV-G Long strain (subtype A) Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-GcDNA Clone Product Information
cDNA Size:897
cDNA Description:ORF Clone of Human RSV (subtype A, strain Long) Major surface glycoprotein G DNA.
Gene Synonym:G, HRSVgp07
Restriction Site:HindIII + XhoI
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P20895.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human RSV glycoprotein G / RSV-G Long strain (subtype A) Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40041-ACG$325
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40041-ACR$325
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40041-CF$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40041-CH$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40041-CM$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40041-CY$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40041-G$95
Human RSV glycoprotein G / RSV-G Long strain (subtype A) Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedVG40041-G-F$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40041-G-N$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40041-NF$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40041-NH$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40041-NM$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40041-NY$295
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40041-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items