After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Influenza A H7N9 (A/Huzhou/10/2013) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H7N9 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Influenza A H7N9 (A/Huzhou/10/2013) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Species:H7N9
Vector:pCMV/hygro
Plasmid:pCMV-H7N9-HU-13-HA
Restriction Site:KpnI + XbaI (5.5kb + 1.68kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H7N9 (A/Huzhou/10/2013) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40356-G-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"