Quick Order

Text Size:AAA

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMK2AcDNA Clone Product Information
cDNA Size:1437
cDNA Description:ORF Clone of Homo sapiens calcium/calmodulin-dependent protein kinase II alpha DNA.
Gene Synonym:CAMKA, KIAA0968
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10648-ACG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10648-ACR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10648-ANG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10648-ANR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10648-CF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10648-CH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10648-CM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10648-CY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone)HG10648-M$95
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10648-M-F$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-M-N$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10648-NF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10648-NH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10648-NM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10648-NY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items