Quick Order

Human NAPG Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAPGcDNA Clone Product Information
Gene_bank_ref_id:BC001889
cDNA Size:939
cDNA Description:ORF Clone of Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, gamma DNA.
Gene Synonym:GAMMASNAP
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

NAPG, also known as gamma SNAP, belongs to the SNAP family. SNAPs enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. NAPG mediates platelet exocytosis and controls the membrane fusion events of this process. It is required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus.

References
  • Lemons PP. et al., 1997, J Cell Biol. 117 (3): 531-8.
  • Chen D. et al., 2001, J Biol Chem. 276 (16): 13127-35.
  • Whiteheart SW. et al., 1992, J Biol Chem. 267 (17): 12239-43.
  • Size / Price
    Catalog:HG14709-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"