Quick Order

Human PROS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROS1cDNA Clone Product Information
Gene_bank_ref_id:BC015801
cDNA Size:2031
cDNA Description:ORF Clone of Homo sapiens protein S (alpha) DNA.
Gene Synonym:PSA, PROS, PS21, PS22, PS23, PS24, PS25, PROS1
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
  • Size / Price
    Catalog:HG12179-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"