After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HTRA2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HTRA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_013247.4
RefSeq ORF Size:1377bp
cDNA Description:Full length Clone DNA of Homo sapiens HtrA serine peptidase 2 with N terminal HA tag.
Gene Synonym:OMI, PARK13, PRSS25
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

References
  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • Size / Price
    Catalog: HG10619-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"