Quick Order

Human CA XII ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CA12 cDNA Clone Product Information
Gene_bank_ref_id:NM_001218.3
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase XII with N terminal HA tag.
Gene Synonym:CAXII, FLJ20151, HsT18816
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA12, also known as Car12 and carbonic anhydrase XII, is a type I  membrane enzyme of an N-terminal extracellular catalytic domain, a membrane-spanning α-helix, and a small intracellular C-terminal domain. It is highly expressed in colon, kidney, prostate, intestine and activated lymphocytes and moderately expressed in pancreas, ovary, and testis. Overexpression of the CA12 is observed in certain human cancers and is used as a tumor marker. rmCA12 corresponds to the extracellular domain and has both carbonic anhydrase activity and esterase activity.

References
  • Sahin, U. et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 92 (25): 11810–11813.
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596 - 12601.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 16903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Catalog: HG10617-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"