Quick Order

Human TIMD4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIMD4cDNA Clone Product Information
cDNA Size:1137
cDNA Description:ORF Clone of Homo sapiens T-cell immunoglobulin and mucin domain containing DNA.
Gene Synonym:TIM4, FLJ27515, SMUCKLER, TIMD4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

A type I transmembrane protein called TIM4 (T-cell immunoglobulin- and mucin-domain-containing molecule; also known as TIMD4), which belongs to the immunoglobulin superfamily and TIM family. TIM4 is involved in regulating T-cell proliferation and lymphotoxin signaling. It is a ligand for HAVCR1/TIMD1. Recent reports indicate that dendritic cell (DC)-derived T-cell immunoglobulin and mucin domain molecule (TIM)-4, which is expressed on dendritic cells and macrophages, plays an important role in the initiation of T(H)2 polarization. TIM4 bound apoptotic cells by recognizing phosphatidylserine via its immunoglobulin domain. The expression of TIM4 in fibroblasts enhanced their ability to engulf apoptotic cells. TIM4 is phosphatidylserine receptor for the engulfment of apoptotic cells, and may also be involved in intercellular signalling in which exosomes are involved. Modulation of TIM4 production in dendritic cells (DCs) represents a novel therapeutic approach for the treatment of peanut allergy. The interaction of TIM1/TIM4 played a critical role in sustaining the polarization status of Th2 cells in allergic rhinitis (AR) patients. Cross-linking FcgammaRI by antigen/IgG complexes increased the production of TIM4 by dendritic cells via upregulating tumor necrosis factor-alpha in DCs. Specific immunotherapy (SIT) suppresses the skewed Th2 responses via disrupting the interaction of TIM1/TIM4 in antigen-specific Th2 cells.

  • Miyanishi M, et al. (2007) Identification of Tim4 as a phosphatidylserine receptor. Nature. 450(7168): 435-9.
  • Feng BS, et al. (2008) Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 122(1): 55-61.
  • Cai PC, et al. (2009) Association of TIM4 promoter polymorphism -1419GA with childhood asthma in a Chinese Han population. Tissue Antigens. 74(1): 11-6.
  • Zhao CQ, et al. (2010) Specific immunotherapy suppresses Th2 responses via modulating TIM1/TIM4 interaction on dendritic cells. Allergy. 65(8): 986-95.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks