Quick Order

Text Size:AAA

Human AMIGO2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AMIGO2 cDNA Clone Product Information
NCBI RefSeq:BC047595
RefSeq ORF Size:1569bp
cDNA Description:Full length Clone DNA of Homo sapiens adhesion molecule with Ig-like domain 2 with N terminal His tag.
Gene Synonym:ALI1, DEGA, AMIGO2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

References
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Catalog: HG13735-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"