Quick Order

Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4McDNA Clone Product Information
Gene_bank_ref_id:NM_014257.3
cDNA Size:1200
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 4, member M DNA.
Gene Synonym:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10559-ACG$325
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10559-ACR$325
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10559-CF$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10559-CH$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10559-CM$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10559-CY$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone)HG10559-M$95
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10559-M-F$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10559-M-N$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10559-NF$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10559-NH$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10559-NM$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10559-NY$295
Human CLEC4M / CD299 / DC-SIGNR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10559-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

References
  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Catalog:HG10559-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"