Quick Order

Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UNGcDNA Clone Product Information
Gene_bank_ref_id:NM_003362.2
cDNA Size:915
cDNA Description:ORF Clone of Homo sapiens uracil-DNA.glycosylase, transcript variant 1 DNA.
Gene Synonym:DGU, UDG, UNG1, UNG2, HIGM4, UNG15, DKFZp781L1143, UNG
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12117-ACG$325
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12117-ACR$325
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12117-ANG$325
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12117-ANR$325
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12117-CF$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12117-CH$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12117-CM$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12117-CY$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG12117-M$95
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12117-NF$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12117-NH$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12117-NM$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12117-NY$295
Human UNG transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12117-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Isoform 1 is widely expressed with the highest expression in skeletal muscle, heart and testicles. Isoform 2 has the highest expression levels in tissues containing proliferating cells. Uracil-DNA glycosylase exists in two forms: mitochondrial uracil-DNA glycosylase 1 (UNG1) and nuclear uracil-DNA glycosylase 2 (UNG2). uracil-DNA glycosylase. This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. Defects in UNG are a cause of immunodeficiency with hyper-IgM type 5 (HIGM5). A rare immunodeficiency syndrome characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. It results in a profound susceptibility to bacterial infections.

References
  • Akbari M, et al. (2007) Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress. Neuroscience. 145(4):1201-12.
  • Slupphaug G, et al. (1996) Properties of a recombinant human uracil-DNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase. Biochemistry. 34(1): 128-38.
  • Pytel D, et al. (2008) Uracil-DNA glycosylases. Postepy Biochem. 54(4): 362-70.
  • Size / Price
    Catalog:HG12117-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"