Quick Order

Human PDGFRα Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDGFRAcDNA Clone Product Information
cDNA Size:3270
cDNA Description:ORF Clone of Homo sapiens platelet-derived growth factor receptor, alpha polypeptide DNA.
Gene Synonym:CD140A, PDGFR2, MGC74795, Rhe-PDGFRA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.


PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items