Quick Order

Human BMP-3b / GDF-10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GDF10cDNA Clone Product Information
Gene_bank_ref_id:NM_004962.2
cDNA Size:1437
cDNA Description:ORF Clone of Homo sapiens growth differentiation factor 10 DNA.
Gene Synonym:BMP3B, BMP-3b, GDF10
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

BMP-3b / GDF-10 is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. In the bone morphogenetic cascade, cartilage differentiation, hypertrophy, and cell death are followed by bone formation. In this regard, all BMPs are cartilage morphogenetic proteins since cartilage is formed first. An overexpression or dysregulation of BMP pathways may lead to heterotopic bone formation or fibrodysplasia ossificans progressiva (FOP). BMPs have been implicated in FOP. The pioneering work of Sakou has implicated BMP-3b / GDF-10 in ossification of the posterior longitudinal ligament of the spine in Japanese patients. The BMP-specific antagonists such as noggin or chordin might be used therapeutically in clinical conditions with pathologically excessive bone formation. The osteoinductive capacity of BMPs has been demonstrated in preclinical models, and the efficacy of BMPs for the treatment of orthopaedic patients is now being evaluated in clinical trials. It was suggested that further progress in the clinical application of the BMP-3b / GDF-10 will depend upon the development of carriers with ideal release kinetics for the delivery of the BMPs.

References
  • Hino J, Takao M, Takeshita N, et al. (1996). "cDNA cloning and genomic structure of human bone morphogenetic protein-3B (BMP-3b).". Biochem. Biophys. Res. Commun. 223 (2): 304–10.
  • Kimura K, Toyooka S, Tsukuda K, et al. (2008). "The aberrant promoter methylation of BMP3b and BMP6 in malignant pleural mesotheliomas.". Oncol. Rep. 20 (5): 1265-8.
  • A. H. Reddi. (2001) Bone Morphogenetic Proteins: From Basic Science to Clinical Applications. Scientific Article. 83:1-6.
  • Size / Price
    Catalog:HG10537-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"