After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RAC1cDNA Clone Product Information
cDNA Size:579
cDNA Description:ORF Clone of Homo sapiens ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), transcript variant Rac1 DNA.
Gene Synonym:MIG5, TC-25, p21-Rac1, MGC111543, RAC1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10535-ACG$325
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10535-ACR$325
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10535-CF$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10535-CH$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10535-CM$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10535-CY$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone)HG10535-M$95
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10535-NF$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10535-NH$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10535-NM$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10535-NY$295
Human RAC1 / MIG5 transcript variant Rac1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10535-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

RAC1 is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for RAC1 gene. RAC1 is a plasma membrane-associated small GTPase which cycles between active GTP-bound and inactive GDP-bound states. In its active state, binds to a variety of effector proteins to regulate cellular responses such as secretory processes, phagocytosis of apoptotic cells, epithelial cell polarization and growth-factor induced formation of membrane ruffles. RAC1 p21/rho GDI heterodimer is the active component of the cytosolic factor sigma 1, which is involved in stimulation of the NADPH oxidase activity in macrophage. RAC1 is essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. RAC1's isoform B has an accelerated GEF-independent GDP/GTP exchange and an impaired GTP hydrolysis, which is restored partially by GTPase-activating proteins. It is able to bind to the GTPase-binding domain of PAK but not full-length PAK in a GTP-dependent manner, suggesting that the insertion does not completely abolish effector interaction.

Stat3 is an important transcription factor that regulates both proinflammatory and anit-apoptotic pathways in the heart. It forms a multiprotein complex with RAC1 and PKC in an H/R-dependent manner by expression of constitutively active Rac1 mutant protein, and by RNA silencing of RAC1. Selective inhibition of PKC with calphostin C produces a marked suppression of Stat3 S727 phosphorylation. The association of Stat3 with Rax1 occurs predominantly at the cell membrane, but also inside the nucleus, and occurs through the binding of the coiled-coil domain of Stat3 to the 54 NH(2)-terminal residues of RAC1. Transfection with a peptide comprising the NH(2)-terminal 17 amino acid residues of RAC1-dependent signaling pathways resulting in physical association between Rac1 and Stat3 and the formation of a novel multiprotein complex with PKC.

  • Kogai T, et al.. (2012) Regulation of sodium iodide symporter gene expression by Rac1/p38β mitogen-activated protein kinase signaling pathway in MCF-7 breast cancer cells. J Biol Chem. 287(5):3292-300.
  • Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.
  • Chang MH, et al. (2012) Prognostic role of integrin β1, E-cadherin, and rac1 expression in small cell lung cancer. APMIS. 120(1):28-38.
  • Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.
  • Mattagajasingh SN, et al. (2012) Activation of Stat3 in endothelial cells following hypoxia-reoxygenation is mediated by Rac1 and protein Kinase C. Biochim Biophys Acta. 1823(5):997-1006.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items