Quick Order

Human AIM2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AIM2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004833.1
RefSeq ORF Size:1032bp
cDNA Description:Full length Clone DNA of Homo sapiens absent in melanoma 2 with C terminal HA tag.
Gene Synonym:PYHIN4, AIM2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.

References
  • Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.
  • Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.
  • Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.
  • Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.
  • Size / Price
    Catalog: HG11654-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"