After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TIM3 / HAVCR2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HAVCR2 cDNA Clone Product Information
Gene_bank_ref_id:NM_032782.3
RefSeq ORF Size:906bp
cDNA Description:Full length Clone DNA of Homo sapiens hepatitis A virus cellular receptor 2 (HAVCR2) with N terminal HA tag.
Gene Synonym:TIM3, KIM-3, TIMD3, Tim-3, FLJ14428, HAVCR2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-HAVCR2
Restriction Site:KpnI + NotI (6kb + 0.93kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Hepatitis A virus cellular receptor 2 (HAVCR2), formerly known as T cell immunoglobulin and mucin domain-3 (TIM-3), is a transmembrane glycoprotein expressed on the surface of terminally differentiated Th1 cells but not on Th2 cells. It was the first surface molecule that specifically identifies Th1 cells in both mice and human. Recently, identification of Galectin-9 as a ligand for TIM-3 has established the TIM-3-Galectin-9 pathway as an important regulator of Th1 immunity and tolerance induction. Engagement of Tim-3 by its ligand galectin-9 negatively regulates IFN-gamma secretion and influences the ability to induce T cell tolerance in both mice and man. It suggests a novel paradigm in which dysregulation of the TIM-3-galectin-9 pathway could underlie chronic autoimmune disease states, such as multiple sclerosis. Recent work has explored the role of TIM-3 in systemic lupus erythematosus (SLE), and their results indicate that TIM-3 may represent a novel target for the treatment of SLE. Numerous studies have demonstrated that Tim-3 influences autoimmune diseases, including diabetes and multiple sclerosis, and its role in other inflammatory diseases including allergies and cancer is beginning to become clear. In tumor rejection model, soluble form of Tim-3 (sTim-3) significantly impaired T cell antitumor immunity, evidenced by decreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. sTim-3 as an immunoregulatory molecule that may be involved in the negative regulation of T cell-mediated immune response.

References
  • Geng H, et al. (2006) Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response. J Immunol. 176(3): 1411-20.
  • Anderson AC, et al. (2006) TIM-3 in autoimmunity. Curr Opin Immunol. 18(6): 665-9.
  • Anderson DE. (2007) TIM-3 as a therapeutic target in human inflammatory diseases. Expert Opin Ther Targets. 11(8): 1005-9.
  • Pan HF, et al. (2010) TIM-3 as a new therapeutic target in systemic lupus erythematosus. Mol Biol Rep. 37(1): 395-8.
  • Size / Price
    Catalog: HG10390-NY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"