Quick Order

Mouse GMPR ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GMPR cDNA Clone Product Information
Gene_bank_ref_id:NM_025508.4
RefSeq ORF Size:1038bp
cDNA Description:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with C terminal Myc tag.
Gene Synonym:AV028449, 2310004P21Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Catalog: MG51395-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"