After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human APEX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APEX1cDNA Clone Product Information
cDNA Size:957
cDNA Description:ORF Clone of Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1 DNA.
Gene Synonym:APE, APX, APE1, APEN, APEX, HAP1, REF1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items