Quick Order

Human AGER transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AGER cDNA Clone Product Information
Gene_bank_ref_id:NM_001136.3
RefSeq ORF Size:1215bp
cDNA Description:Full length Clone DNA of Homo sapiens advanced glycosylation end product-specific receptor, transcript variant 1 with C terminal HA tag.
Gene Synonym:RAGE, MGC22357, AGER
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-AGER-t1-HA
Restriction Site:KpnI + XbaI (6kb + 1.26kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

References
  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • Size / Price
    Catalog: HG11629-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"