After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PVRL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PVRL1cDNA Clone Product Information
cDNA Size:1554
cDNA Description:ORF Clone of Homo sapiens poliovirus receptor-related 1 (herpesvirus entry mediator C) DNA.
Gene Synonym:ED4, PRR, HIgR, HVEC, OFC7, PRR1, PVRR, CD111, PVRR1, SK-12, CLPED1, MGC16207, nectin-1, MGC142031, PVRL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin-1; CD111), also known as PVRL1 is a cell adhesion molecule belonging to the immunoglobulin superfamily that can bind to virion glycoprotein D (gD) to mediate entry of herpes simplex viruses (HSV) and pseudorabies virus (PRV). CD111/Nectin-1/PVRL1 colocalizes with E-cadherin at adherens junctions in epithelial cells. The disruption of cell junctions can result in the redistribution of nectin-1. To determine whether disruption of junctions by calcium depletion influenced the susceptibility of epithelial cells to viral entry, Madin-Darby canine kidney cells expressing endogenous nectin-1 or transfected human nectin-1 were tested for the ability to bind soluble forms of viral gD and to be infected by HSV and PRV, before and after calcium depletion. It has been revealed that binding of HSV and PRV gD was localized to adherens junctions in cells maintained in normal medium but was distributed, along with nectin-1, over the entire cell surface after calcium depletion. Both the binding of gD and the fraction of cells that could be infected by HSV-1 and PRV were enhanced by calcium depletion. Taken together, CD111/Nectin-1/PVRL1 confined to adherens junctions in epithelial cells is not very accessible to virus, whereas dissociation of cell junctions releases nectin-1 to serve more efficiently as an entry recptor.

  • Yoon M, et al. (2002) Disruption of adherens junctions liberates nectin-1 to serve as receptor for herpes simplex virus and pseudorabies virus entry. J Virol. 76(14): 7203-8.
  • Mata M, et al. (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7(5): 476-80.
  • Haarr L, et al. (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology. 287(2): 301-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items