Quick Order

Text Size:AAA

Human LRRN3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRRN3 cDNA Clone Product Information
NCBI RefSeq:BC035133.2
RefSeq ORF Size:2127bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine rich repeat neuronal 3 with C terminal HA tag.
Gene Synonym:NLRR3, NLRR-3, FIGLER5, FLJ11129, LRRN3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Leucine-rich repeat neuronal protein 3, also known as neuronal leucine-rich repeat protein 3 (NLRR-3), is a member of leucine-rich (LRR) family whose members have significant functions in neural development. Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. All proteins containing these repeats are thought to be involved in protein-protein interactions. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged so that they form a parallel β-sheet with one surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two features may be responsible for the protein-binding functions of proteins containing leucine-rich repeats. LRRN3 plays an important role in cerebellum postnatal development. In a unilateral cortical injury cerebral cortex, NLRR-3 mRNA increased in layers 2-3 which suggests that NLRR-3 may be an important component of the pathophysiological response to brain injury. 

References
  • Yang J, et al. (2011) Role of LRRN3 in the cerebellum postnatal development in rats. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36 (5): 424-9.
  • Hutcheson HB, et al. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med Genet. 5: 12.
  • Ishii N, et al. (1996) Increased expression of NLRR-3 mRNA after cortical brain injury in mouse. Brain Res Mol Brain Res. 40 (1): 148-52.
  • Size / Price
    Catalog: HG11610-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"