Quick Order

Human ICOS Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICOScDNA Clone Product Information
cDNA Size:600
cDNA Description:ORF Clone of Homo sapiens inducible T-cell co-stimulator DNA.
Gene Synonym:AILIM, CD278, MGC39850
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items